Define where the pipeline should find input data and save output data.

Path to comma-separated file containing information about the samples in the experiment.

required
type: string
pattern: ^\S+\.csv$

The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.

required
type: string

Email address for completion summary.

type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

MultiQC report title. Printed as page header, used for filename if not otherwise specified.

type: string

Choose the data types that should be simulated by the pipeline.

Option to simulate amplicon sequencing reads.

type: boolean

Option to simulate target capture sequencing reads.

type: boolean

Option to simulate metagenomic sequencing reads.

type: boolean

Option to simulate wholegenomic sequencing reads.

type: boolean

Options for simulating amplicon sequencing reads.

Forward primer to use with crabs_insilicopcr.

type: string
default: GTCGGTAAAACTCGTGCCAGC

Reverse primer to use with crabs_insilicopcr.

type: string
default: CATAGTGGGGTATCTAATCCCAGTTTG

Number of reads to be simulated per amplicon.

type: integer
default: 500

Length of reads to be simulated.

type: integer
default: 130

Sequencing system of reads to be simulated.

type: string

Maximum number of errors allowed in CRABS insilicoPCR primer sequences

type: number
default: 4.5

Options for simulating target capture sequencing reads.

Path to bait/probe file. Can be a fasta file or a bed file.

type: string

Name of supported probe. Mandatory if not using --probes parameter.

type: string

Simulate ‘illumina’ or ‘pacbio’ reads.

type: string

Median of fragment size at shearing.

type: integer
default: 500

Shape parameter of the fragment size distribution.

type: number
default: 6

Median of fragment size distribution.

type: integer
default: 1300

Shape parameter of the fragment size distribution.

type: number
default: 6

Median of target fragment size (the fragment size of the data). If specified, will override ‘–fmedian’ and ‘–smedian’. Othersise will be estimated.

type: integer

Shape parameter of the effective fragment size distribution.

type: number

Number of fragments.

type: integer
default: 500000

Illumina: read length.

type: integer
default: 150

PacBio: Average (polymerase) read length.

type: integer
default: 30000

Illumina: Sequencing mode.

type: string

Options for simulating metagenomic sequencing reads.

Abundance distribution.

type: string

Path to tab-separated file containing abundance distribution.

type: string
pattern: ^\S+\.tsv$

Coverage distribution.

type: string

Path to tab-separated file containing coverage information.

type: string
pattern: ^\S+\.tsv$

Format of FASTA file used to generate reads

type: string

Number of reads to generate.

type: string
default: 1M

Can be ‘kde’, or ‘basic’.

type: string

Can be ‘HiSeq’, ‘NovaSeq’, or ‘MiSeq’.

type: string

Use this option to prevent simulating reads that have abnormal GC content.

type: boolean

Options for simulating wholegenome sequencing reads.

The base error rate.

type: number
default: 0.02

The outer distance between the two ends.

type: integer
default: 500

The standard deviation.

type: integer
default: 50

The number of read pairs.

type: integer
default: 1000000

The length of the first reads.

type: integer
default: 70

The length of the second reads.

type: integer
default: 70

The rate of mutations.

type: number
default: 0.001

The fraction of indels.

type: number
default: 0.15

The probability that an indel is extended.

type: number
default: 0.3

Reference genome related files and options required for the workflow.

Name of iGenomes reference.

type: string

Path to reference FASTA file.

type: string
pattern: ^\S+\.fn?a(sta)?(\.gz)?$

Do not load the iGenomes reference config.

hidden
type: boolean

Path to text file containing accession ids (one accession per row).

type: string

Path to text file containing taxids (one taxid per row).

type: string

The NCBI taxonomic groups to download. Options include ‘all’, ‘archaea’, ‘bacteria’, ‘fungi’, ‘invertebrate’, ‘metagenomes’, ‘plant’, ‘protozoa’, ‘vertebrate_mammalian’, ‘vertebrate_other’, and ‘viral’. A comma-separated list is also valid (e.g., ‘bacteria,viral’).

type: string
default: all

The NCBI section to download. ‘refseq’ or ‘genbank’.

type: string

Parameters used to describe centralised config profiles. These should not be edited.

Git commit id for Institutional configs.

hidden
type: string
default: master

Base directory for Institutional configs.

hidden
type: string
default: https://raw.githubusercontent.com/nf-core/configs/master

Institutional config name.

hidden
type: string

Institutional config description.

hidden
type: string

Institutional config contact information.

hidden
type: string

Institutional config URL link.

hidden
type: string

Set the top limit for requested resources for any single job.

Maximum number of CPUs that can be requested for any single job.

hidden
type: integer
default: 16

Maximum amount of memory that can be requested for any single job.

hidden
type: string
default: 128.GB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Maximum amount of time that can be requested for any single job.

hidden
type: string
default: 240.h
pattern: ^(\d+\.?\s*(s|m|h|d|day)\s*)+$

Less common options for the pipeline, typically set in a config file.

Display help text.

hidden
type: boolean

Display version and exit.

hidden
type: boolean

Method used to save pipeline results to output directory.

hidden
type: string

Email address for completion summary, only when pipeline fails.

hidden
type: string
pattern: ^([a-zA-Z0-9_\-\.]+)@([a-zA-Z0-9_\-\.]+)\.([a-zA-Z]{2,5})$

Send plain-text email instead of HTML.

hidden
type: boolean

File size limit when attaching MultiQC reports to summary emails.

hidden
type: string
default: 25.MB
pattern: ^\d+(\.\d+)?\.?\s*(K|M|G|T)?B$

Do not use coloured log outputs.

hidden
type: boolean

Incoming hook URL for messaging service

hidden
type: string

Custom config file to supply to MultiQC.

hidden
type: string

Custom logo file to supply to MultiQC. File name must also be set in the MultiQC config file

hidden
type: string

Custom MultiQC yaml file containing HTML including a methods description.

type: string

Boolean whether to validate parameters against the schema at runtime

hidden
type: boolean
default: true

Show all params when using --help

hidden
type: boolean

Validation of parameters fails when an unrecognised parameter is found.

hidden
type: boolean

Validation of parameters in lenient more.

hidden
type: boolean