Introduction
The nf-core/crisprseq pipeline allows the analysis of CRISPR edited DNA. It evaluates the quality of gene editing experiments using targeted next generation sequencing (NGS) data.
Samplesheet input
You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 6 columns, and a header row as shown in the examples below.
--input '[path to samplesheet file]'Multiple runs of the same sample
The sample identifiers have to be the same when you have re-sequenced the same sample more than once e.g. to increase sequencing depth. The pipeline will concatenate the raw reads before performing any downstream analysis. Below is an example for the same sample sequenced across 3 lanes (see section below for an explanation of samplesheet columns):
sample,fastq_1,fastq_2,reference,protospacer,templateCONTROL_REP1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gz,GCT...CCT,GGGGCCACTAGGGACAGGAT,CONTROL_REP1,AEG588A1_S1_L003_R1_001.fastq.gz,AEG588A1_S1_L003_R2_001.fastq.gz,GCT...CCT,GGGGCCACTAGGGACAGGAT,CONTROL_REP1,AEG588A1_S1_L004_R1_001.fastq.gz,AEG588A1_S1_L004_R2_001.fastq.gz,GCT...CCT,GGGGCCACTAGGGACAGGAT,Full samplesheet
The pipeline will auto-detect whether a sample is single- or paired-end using the information provided in the samplesheet. The samplesheet can have as many columns as you desire, however, there is a strict requirement for the first 6 columns to match those defined in the table below.
A final samplesheet file consisting of both single- and paired-end data may look something like the one below. This is for 3 samples, where chr6 is single-end and has a template sequence (this is a reduced samplesheet, please refer to the pipeline example samplesheet to see the full version).
sample,fastq_1,fastq_2,reference,protospacer,templatehCas9-TRAC-a,hCas9-TRAC-a_R1.fastq.gz,hCas9-TRAC-a_R2.fastq.gz,GCT...CCT,GGGGCCACTAGGGACAGGAT,hCas9-AAVS1-a,hCas9-AAVS1-a_R1.fastq.gz,hCas9-AAVS1-a_R2.fastq.gz,GCT...CCT,GGGGCCACTAGGGACAGGAT,chr6,chr6-61942198-61942498_R1.fastq.gz,,CAA...GGA,TTTTATGATATTTATCTTTT,TTC...CAA| Column | Description |
|---|---|
sample |
Custom sample name. This entry will be identical for multiple sequencing libraries/runs from the same sample. Spaces in sample names are automatically converted to underscores (_). |
fastq_1 |
Full path to FastQ file for Illumina short reads 1. File has to be gzipped and have the extension “.fastq.gz” or “.fq.gz”. |
fastq_2 |
Full path to FastQ file for Illumina short reads 2. File has to be gzipped and have the extension “.fastq.gz” or “.fq.gz”. (Optional) |
reference |
Reference sequence of the target region. |
protospacer |
Sequence of the protospacer used for CRISPR editing. Must not include the PAM. |
template |
Sequence of the template used in template-based editing experiments. (Optional) |
An example samplesheet has been provided with the pipeline.
Optional pipeline steps
Trimming of overrepresented sequences
To trim the overrepresented sequences found with FastQC from the reads, use the parameter --overrepresented.
Such sequences are not trimmed by default.
When using the --overrepresented parameter, Cutadapt is used to trim overrepresented sequences from the input FASTQ files.
UMI clustering
If the provided samples were sequenced using umi-molecular identifiers (UMIs), use the parameter --umi_clustering in order to run the clustering steps.
- Extract UMI sequences (Python script)
- Cluster UMI sequences (
Vsearch) - Obtain the most abundant UMI sequence for each cluster (
Vsearch) - Obtain a consensus for each cluster (
minimap2) - Polish consensus sequence (
racon) - Repeat a second round of consensus + polishing (
minimap2+racon) - Obtain the final consensus of each cluster (Medaka)
Other input parameters
Reference
If you want to provide the same reference for every sample, you can select a genome with --genome or provide a reference FASTA file with --reference_fasta.
Using any of these two parameters will override any reference sequence provided through an input sample sheet.
Please refer to the nf-core website for general usage docs and guidelines regarding reference genomes.
Protospacer
If you want to provide the same protospacer sequence for every sample, you can provide the sequence with the parameter --protospacer.
Using this parameter will override any protospacer sequence provided through an input sample sheet.
Providing a protospacer, either through a sample sheet or by using the parameter --protospacer is required.
Alignment options
By default, the pipeline uses minimap2 (i.e. --aligner minimap2) to map the sequenced FASTQ reads to the reference.
You also have the option to select other alignment tools by using the parameter --alignment. Possible options are minimap2, bwa or bowtie2.
The default alignment with minimap2 uses adapted parameters which were seen to improve the alignment and reduce potential sequencing or alignment errors.
The default parameters are:
- A matching score of 29
- A mismatching penalty of 17
- A gap open penalty of 25
- A gap extension penalty of 2.
Please refer to the original CRISPR-Analytics publication to see the benchmarking of such parameters.
In order to customise such parameters, you can override the arguments given to minimap2 by creating a configuration file and provide it to your nextflow run with -c:
process { withName: MINIMAP2_ALIGN_ORIGINAL { ext.args = '-A 29 -B 17 -O 25 -E 2' }}Command:
nextflow run nf-core/crisprseq --input samplesheet.csv --analysis targeted --outdir <OUTDIR> -profile docker -c custom.configRunning the pipeline
The typical command for running the pipeline is as follows:
nextflow run nf-core/crisprseq --input samplesheet.csv --analysis targeted --outdir <OUTDIR> -profile dockerThis will launch the pipeline with the docker configuration profile. See below for more information about profiles.
Note that the pipeline will create the following files in your working directory:
work # Directory containing the nextflow working files<OUTDIR> # Finished results in specified location (defined with --outdir).nextflow_log # Log file from Nextflow# Other nextflow hidden files, eg. history of pipeline runs and old logs.